(Cat#F7110, Aurora, CO, USA) was used at 10 M for the duration of HIV + EtOH treatment

(Cat#F7110, Aurora, CO, USA) was used at 10 M for the duration of HIV + EtOH treatment. inflammation and fibrosis due to constant activation of NPCs. and Alcohol Dehydrogenase (expression in 24 h [22], and because the sustained expression of these ethanol-metabolizing enzymes is necessary for successful ethanol treatment, cells were plated on custom soft gels (polyelectrolyte multilayer (PEM) film coating on top of the polydimethyl siloxane surface, two-dimensional (2D) culture) to support long-term cell functionality (described in [23]). Due to limited availability of human hepatocytes, for their experimental prototype we also used Huh7.5-CYP (RLW) cells. These cells have reduced innate immunity and can be infected with HIV. They were stably transfected to metabolize ethanol by CYP2E1, but do not express ADH. To overcome this limitation, we treated RLW cells with an acetaldehyde-generating system (AGS), which contains yeast ADH as a source of enzyme, nicotinamide adenine dinucleotide (NAD) as a co-factor, and 50 mM ethanol (EtOH) (substrate for ADH), and continuously produces physiologically relevant amounts of acetaldehyde (Ach) without toxic effects. We have characterized and successfully used these cells and AGS for HCV-based ethanol in vitro studies [24,25]. The downstream effects of AGS were validated by experiments on ethanol-treated primary hepatocytes. Pancaspase inhibitor (PCI) from Ubiquitin-Proteasome Biotechnologies (UBPBio) Inc. (Cat#F7110, Aurora, CO, USA) was used at 10 M for the duration of HIV + EtOH treatment. Proteasome inhibitors MG132 Rabbit Polyclonal to PPM1K (Cat#F1100; 5 M overnight) and carfilzomib (Cat#F1300; 100 nM overnight) from UBPBio, Inc. (Aurora, CO, USA), and lysosome inhibitors bafilomycin (Sigma; #B1793; 50 nM overnight) and chloroquine (Sigma; #C6698; 5, 20, 50 M overnight) were used in this study. The HIV replication inhibitor azidothymidine (AZT) was used at a 100 mM concentration during HIV + EtOH treatment. 2.3. Human Monocyte-Derived Macrophages Monocytes were obtained from healthy donor blood elutriation. Monocyte suspensions were documented as 98% pure by criteria of AGK2 cell AGK2 morphology in Wright-stained cytosmears. Monocytes were cultured in 48-well plates (2 105 cells/well) in DMEM (Sigma) with 10% heat-inactivated pooled human serum, 1% glutamine, 50 g/mL gentamicin, and/or 10 g/mL ciprofloxacin (Sigma) and human CSF-1. Culture medium was changed every three days. All tissue culture reagents were screened and found negative for endotoxin (10 pg/mL; Associates of Cape Cod, Woods Hole, AGK2 MA, USA) and mycoplasma contamination (Gen-Probe II; Gen-Probe, San Diego, CA, USA). After seven days in culture, monocyte-derived macrophages (MDMs) were used for experiments. 2.4. AGK2 Hepatic Stellate Cells (HSCs) As the source of human hepatic stellate cells (HSCs), we used commercially available human cell line LX2 (EMD Millipore, cat SCC064) grown based on instructions from the manufacturer. 2.5. AGK2 Apoptotic Body (AB) Generation and Treatment Macrophages and Hepatic Stellate Cells with Apoptotic Hepatocytes To mimic apoptosis triggered by EtOH metabolism in HIV-infected hepatocytes, HIV-infected and non-infected cells were exposed to UV light (0C100 mJ/cm2, 140 s) to make ABHep. In 24 h, ABs were collected from supernatant by pelleting the cells at 1500 rpm for 5 min and re-suspended in DMEM. They were exposed to MDMs and LX2-cells at a 3:1 ratio as previously described [26]. 2.6. RNA Isolation, Real-Time Polymerase Chain Reaction, and Western Blotting Human immunodeficiency virus-RNA (HIV RNA), interferon-stimulated genes (ISGs) with anti-viral activities such as Interleukin (GCCTCCCAAAGTGCTGGGATTACA) and 600 nM reverse primers GTTCCTGC TATGTCACTTCC), as described previously [29]. Further, the product of first PCR was quantified for integrated DNA by the ddPCR method. Briefly, the final PCR reaction was comprised of ddPCR supermix (Bio-Rad), 900 nM primers (sense 5-TCAGCCCAGAAGTAATACCCATGT-3 and antisense 5-CACTGTGTTTAGCATGGTGTTT-3), a 250 nM probe (FAM-ATTATCAGAAGGAGCCACCCCACAAGA3-ZEN/Iowa Black FQ), and 4 uL of first PCR product in a final volume of 20 L, and loaded into an eight-channel disposable droplet generator cartridge (Bio-Rad). Generated droplets were then transferred into a 96-well PCR plate, heat-sealed with foil, and then amplified to endpoint using a BioRad C1000 Touch PCR cycler at 95 C for 10 min, then 40 cycles of 94 C for 15 s, and 60 C for 1 min (2 C/s ramp rate) with a final step.